The Effect of Translationally Controlled Tumor Protein (TCTP) of the Arctic Copepod Calanus glacialis on Protecting Escherichia coli Cells against Oxidative Stress

북극 동물플랑크톤 Calanus glacialis TCTP (Translationally Controlled Tumor Protein)가 산화적 스트레스 상태에서 E. coli 세포의 저항성에 미치는 효과

Abstract

Translationally controlled tumor protein (TCTP) is one of the most abundant proteins in various eukaryotic organisms. TCTPs play important roles in cell physiological processes in cancer, cell proliferation, gene regulation, and heat shock response. TCTP is also considered an important factor in the resistance to oxidative stress induced by dithiothreitol or hydrogen peroxide (H₂O₂). Arctic calanoid copepods have a variety of antioxidant defense systems to regulate the levels of potentially harmful reactive oxygen species generated by ultraviolet radiation in the Arctic marine ecosystem. However, information on the antioxidant activity of TCTP in the Arctic Calanus glacialis is still scarce. To understand the putative antioxidant function of the Arctic copepod C. glacialis TCTP (Cg-TCTP), its gene was cloned and sequenced. The Cg-TCTP comprised 522 bp and encoded a 174-amino acid putative protein with a calculated molecular weight of ~23 kDa. The recombinant Cg-TCTP (Cg-r TCTP) gene was overexpressed in Escherichia coli (BL21), and Cg-rTCTP-transformed cells were grown in the presence or absence of H₂O₂. Cg-rTCTP-transformed E. coli showed increased tolerance to high H₂O₂ concentrations. Therefore, TCTP may be an important antioxidant protein related to tolerance of the Arctic copepod C. glacialis to oxidative stress in the harsh environment of the Arctic Ocean.

TCTP는 다양한 진핵생물에서 풍부하게 존재하는 단백질 중에 하나이며, 암, 세포 증식, 유전자 조절 등과 관련된 세포의 생리학적 기작에서 중요한 역할을 담당하는 것으로 알려져 왔다. 더구나, TCTP는 dithiothreitol (DTT)나 hydrogen peroxide (H₂O₂)에 의해 유도되는 산화적 스트레스에 대한 저항성에 관여하는 중요한 단백질로 주목 받아 왔다. 한편, 극지역 서식 생물들은 강한 자외선에 의해 발생한 활성산소를 조절하기 위한 다양한 항산화 방어체계를 가지고 있다. 본 연구에서는 북극 동물플랑크톤 Calanus glacialis에서 분리된 TCTP가 산화적 스트레스 하에서 E. coli 세포의 저항성에 미치는 효과를 관찰하였다. C. glacialis에서 분리된 TCTP 유전자(ORF 522 bp) 서열을 분석하였고, 약 23 kDa의 재조합 단백질을 제작하였다. 관찰 결과, TCTP 재조합 단백질이 E. coli 세포에서 과발현 되었을 때, 세포들은 H₂O₂에 의해 유도된 산화적 스트레스에 대한 저항성이 증가하는 것을 확인하였다. 본 관찰을 통해, 북극 C. glacialis TCTP 단백질의 항산화 조절자로서의 역할에 대한 가능성을 처음으로 제시하였다.

Introduction

The translationally controlled tumor protein (TCTP) is highly conserved among eukaryotes, and it was originally described as being a growth-related protein in mouse ascites and erythro-leukemic cells [4]. In several organisms, TCTPs are related to diverse cellular processes including apoptosis, microtubule organization, and ion homeostasis, and to interact with many proteins [4].

Oxidative stress is known to drive and support the aging process and the development of various diseases; therefore, there has been a growing interest on identifying genes that can protect cells from oxidative stress damaging effects. Several studies demonstrated that TCTP has important functions in cell growth and anti-apoptotic activity [6, 14, 23, 26]. In particular, upregulation of cellular TCTP levels induced by oxidative stress were found to affect the cellular protection against cell death. Indeed, TCTP upregulation induced by treatment with hydrogen peroxide (H₂O₂) or arsenic trioxide was observed in breast cancer [23]. However, in the case of another tumorigenic cell line (CHO-K1), H₂O₂ treatment did not enhanced TCTP levels [26]. Overall, the underlying mechanism of oxidative stress-promoted TCTP upregulation remains poorly understood.

Reactive oxygen species (ROS), such as H₂O₂, superoxide, and hydroxyl radicals, are produced in cells in the course of normal metabolism, as a result of various oxidative reactions. In vitro treatment of cells with exogenous H₂O₂ has been related to intracellular ROS production, with ROS accumulation inside cells triggering DNA strand breaks, the oxidation of lipids, and the decrease of intracellular antioxidants. Moreover, if the oxidative stress is low, cells may surrender to the cytotoxic effects of the accumulated ROS and die by either apoptosis or necrosis, according to the type of cell and microenvironment conditions [13, 25, 29]. Polar coastal ecosystems have been threatened by increased ultraviolet B (UV-B) radiation due to ozone depletion [24]. UV-B radiation can penetrate significant biological depths in seawater and causes biological damage by altering the DNA in the nuclei of the cells [8]. Direct UV-B exposure has been associated with physiological and biological processes in Arctic amphipods [28], northern temperate zooplankton, and ichthyoplankton [7]. UV-B has been also linked to oxidative stress, as it can induce the generation of ROS in surface waters [1] and to influence the Arctic marine ecosystem [17].

Copepod species of the genus Calanus take part in a predominant proportion of zooplankton biomass in the Arctic Ocean, and they have been proposed as useful model organisms for toxicology, genetics, and molecular biology studies[2, 19, 26]. Indeed, copepods have provided interesting insights into stress reactions in gene profiling studies [16, 21, 22]. Interestingly, in order to regulate ROS, the Arctic calanoid copepods have a variety of antioxidant defense systems. However, to date, little is known on the potential antioxidant effect of TCTP in the Arctic Calanus glacialis.

In this study, the antioxidant activity of TCTP was analyzed in Arctic copepod C. glacialis in Escherichia coli cells under stress conditions driven by H₂O₂. Such information may provide additional insights on the antioxidant potential of TCTP.

Materials and Methods

Sample collection

C. glacialis was collected in July 2005 from the seawater around the Korea Arctic Research Station, Dasan, in NyÅlesund, Svalbard, Norway (79°N, 12°E). Samples were homogenized in TRIzol reagent for RNA extraction. The identification of this species was conducted by partial large subunit ribosomal DNA (LSU rDNA) sequence analysis [18].

Amplification of TCTP

Total RNA was extracted using easy-BLUE Total RNA Extraction kit (Intron, Seongnam, Korea), and was dissolved in RNase-free water. The isolated RNA was stored at −80℃ until further use. To synthesize complementary DNA (cDNA), 2 μg of total RNA was used, and the cDNA was synthesized using the M-MLV Reverse Transcriptase kit (Enzynomics, Daejeon, Korea) according to the manufacturer’s instructions. For recombinant protein expression, the open reading frame (ORF) of TCTP (Cg-TCTP) was amplified by polymerase chain reaction (PCR) as per the following conditions: 35 cycles of 94℃ for 30 sec, 46℃ for 30 sec, 72℃ for 50 sec, with a final extension at 72℃ for 10 min. Primers were designed from the expressed sequence tags of C. glacialis. The nucleotide sequences of the forward and reverse PCR primers were 5'ATGAAGATCTTCAAGGATGT–3' and 5'–CTAGCACT TCTCCTCTTCAAGAC–3', respectively. The amplified fragment was purified using a PCR product purification kit (Intron, Seongnam, Korea).

Expression of and purification of recombinant CgTCTP

The PCR product was directly inserted into the pEXP5 TOPO TA vector (Invitrogen, Waltham, Massachysetts, USA), which was used to transform E. coli BL21 (DE3) cells. The cloning strategy was designed to induce the expression of TCTP from C. glacialis containing an additional C-terminal His6 tag (Cg-rTCTP). The transformants were spread onto Lauria–Bertani (LB) agar plates containing 50 μg/ml ampicillin and incubated at 37℃, and recombinant cells were cultured on LB medium containing 50 μg/ml ampicillin. Protein expression was induced as the culture optical density (OD) reached 0.7 to 0.8 by the addition of 0.5 and 1 mM isopropyl β-D-thiogalactopyranoside (IPTG). Optimal expression of Cg-rTCTP was achieved at 0.5 mM IPTG. Cg-rTCTP was directly analyzed on a 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis and stained with Coomassie brilliant blue (Bio-Rad, Hercules, California, USA). The protein samples were boiled for 10 min at 100℃ before being loaded onto the gel. Subsequently, the histidine-tagged recombinant proteins were purified using an immobilized metal affinity column chromatography (Clontech, Kusatsu, Japan) according to the manufacturer's recommendations.

Immunoblotting

Upon the gel electrophoresis, the proteins were transferred to a PVDF membrane (Millipore, Cambridge, Massachysetts, USA). Afterwards, the membrane was blocked with 5% skim milk and incubated for 2 hr at room temperature with an Anti-His6 IgG (1:500; Roche, Buonas, Switzerland), followed by a peroxidase-conjugated AffiniPure F(ab’)2 fragment anti-chicken IgG (H+L) (1:20,000; Jackson ImmunoResearch Laboratories, West Grove, Pennsylvania, USA) for additional 1 hr at room temperature. Next, the PVDF membrane was washed, and the SUPEX Western blot detection kit (Neuronex, Providence, Rhode Island, USA) was used to visualize the protein signals. The respective images were detected with a luminescent image analyzer (LAS-3000; Fujifilm, Tokyo, Japan).

H₂O₂ tolerance bioassay

To test the sensitivity of E. coli cells to H₂O₂, Cg-rTCTPtransformed bacterial cells were grown until the OD range of the culture reached 0.7-0.8. Then, the cultures were induced with IPTG at a final concentration of 0.5 mM added to the LB medium containing ampicillin. H₂O₂ was serially added to the induced bacterial cells, ranging from 1 to 20 mM and cultured for 12 and 24 hr. A plate culture was used to test the diluted cells (ranging from 1:1 to 1:10), with 10µl of each dilution being platted on LB agar medium containing 3 and 5 mM H₂O₂. Plates were then incubated at 37℃ overnight. Bacterial cells expressing the empty vector were similarly plated as controls. Growth of the bacterial cells after incubation was compared between the control and experimental groups.

Results

Sequence analysis of C. glacialis TCTP

To evaluate the TCTP sequence, its ORF was obtained from the full-length C. glacialis cDNA. The resulting ORF comprised 522 bp, encoding 173 amino acids. Based on a BLAST search using the inferred amino acid sequence, Cg-TCTP showed high similarity of sequence identity with other eukaryotic TCTP genes. Alignment of the predicted Cg-TCTP sequence with the corresponding TCTP from eight different organisms showed a high degree of preservation over long-term evolution. According to the characteristic features of TCTPs, Cg-TCTP also comprised distinctly specified TCTP-1 and TCTP-2 signature, which represent the amino acid positions 45-56 and 129-152, respectively. Alignment of the basic amino acid-rich domain sequences revealed similarities with part of the microtubule-binding domain (MTB) and calcium-binding domain (CaB). Moreover, the Cg-TCTP amino acid sequence showed 71% homology with that of Tigriopus japonicus. In addition, alignment of Cg-TCTP with TCTP homologue proteins of T. japonicus (accession AAR 88095), Brugia malay (XP_001897741), Caenorhabditis elegans (Q93573), Drosophila melanogaster (Q9VGS2), yeast (NP_594328), Arabidopsis thaliana (AAM66134), mouse (P14701), and human (NP_003286) was determined using ClustalW (Fig. 1).

Fig. 1. Multiple sequence alignment of various TCTPs was determined using the ClustalW software. The boxes show the TCTP-1 and TCTP-2 signature regions. Calcium-binding (CaB) and microtubule binding (MTB) regions are indicated by dark and white bars, respectively.

Expression of C. glacialis TCTP

The cDNA of C. glacialis TCTP was inserted into a eukaryotic expression vector, which was used to induce the expression of a recombinant Cg-TCTP in E. coli. Analysis of the obtained Cg-sTCTP revealed a ~23 kDa protein on SDS-PAGE (Fig. 2A, lane 3), which was detected in low amounts in both insoluble and soluble fractions of the cell extracts (Fig. 2A, lane 2). The Cg-rTCTP expression in E. coli was detected by immunoblotting using a monoclonal antibody against His-tag (Fig. 2B).

Fig. 2. Chromatographic purification and separation of Cg-TCTP protein. Optimal expression of Cg-rTCTP was achieved at 0.5 mM IPTG. Cg-rTCTP was directly analyzed on a 10% sodium dodecyl sulphate-polyacrylamide gel and stained with Coomassie brilliant blue. The histidine- tagged recombinant proteins were purified using an immobilized metal affinity column chromatography. A. 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) results before (lane 1) and after (lane 2) induction. Recombinant Cg-TCTP protein purified on a Co-NTA column (lane 3). B. Immunoblot analysis of the recombinant protein (lane 1; control vector, lane 2; His-tagged Cg-rTCTP). The arrows indicate the TCTP recombinant protein.

Evaluation of Cg-rTCTP-transformed E. coli cells resistance to H₂O₂

To further confirm the antioxidant potential of Cg-rTCTP, E. coli cells expressing the recombinant protein or the empty vector alone were cultured in media containing 0-5 mM H₂O₂ for 24 hr. The survival rate of the cells transformed with the empty vector (control) was reduced by approximately 36-40% at 2 and 5 mM H₂O₂ compared with cells in the absence of H₂O₂, whereas Cg-rTCTP-transformed cell survival was largely unaffected by H₂O₂-induced toxicity (Fig. 3). In plate cultures containing 5 mM H₂O₂, which was a critical concentration for inhibiting cell growth, E. coli cells harboring TCTP and the empty vector did not survived (Fig. 4C). However, Cg-rTCTP-producing cells survived at a density of 1:5 in medium containing 3 mM H₂O₂ (Fig. 4B).

Fig. 3. Comparison of growth resistance to hydrogen peroxide (H₂O₂) between Escherichia coli transformed with pEXP5 TOPO TA vector containing C. glacialis TCTP and pEXP5 TOPO TA vector alone as control. In order to confirm the antioxidant potential of Cg-rTCTP, E. coli cells expressing the recombinant protein or the empty vector alone were cultured in media containing 0-5 mM H₂O₂ for 24 hr. Survival capacity of control E. coli (white box) and bacteria expressing the recombinant Cg-TCTP (black box) in the presence of difference concentrations of H₂O₂ for 24 hr.

Fig. 4. Hydrogen peroxide (H₂O₂) tolerance of E. coli cells transformed with Cg-rTCTP gene. Cells were serially diluted (from 1:1 to 1:10) and were plated on LB agar containing different concentrations (0 mM, 3 mM, or 5 mM) of H₂O₂. After incubation for 12 hr at 37℃, the growth of cells harboring the empty vector was inhibited, whereas cells expressing Cg-rTCTP showed enhanced growth up to a dilution of 1:5 in the presence of 3 mM H₂O₂ (B).

Additional analyses revealed that as soon as E. coli cells were exposed toH₂O₂, their logarithmic growth was impaired and the culture reached a stationary-like phase. When the H₂O₂ concentration was 3 mM, which was critical concentration for inhibiting cell growth in plate culture, the survival status of E. coli expressing Cg-rTCTP was maintained as compared with the control group (Fig. 5).

Fig. 5. Growth curves of control (pEXP5 TOPO TA vector control) and transformed (Cg-rTCTP) E. coli cells in LB medium containing ampicillin. A plate culture was used to test the diluted cells (ranging from 1:1 to 1:10), with 10 μl of each dilution being platted on LB agar medium containing 3 mM H₂O₂ for 24 hr. Bacterial cells expressing the empty vector were similarly plated as controls. Growth of the bacterial cells after incubation was compared between the control and experimental groups. Growth was monitored spectrophotometrically by following the optical density at A600 nm.

Discussion

This study is the first report on the antioxidant activity of TCTP from C. glacialis in the Arctic Ocean. Aquatic organisms are frequently exposed to environmental factors (e.g., cold, heat, and osmotic conditions) and chemical stresses (e.g., endocrine disruptor chemicals and hydrocarbons). Therefore, organisms may respond to these stresses by activating different cellular mechanisms [20], with protective reactions being described in both prokaryotes and eukaryotes[27]. To date, few studies on gene expression and stress response from marine copepods have been published, although they are known to have defense mechanisms [20]. Indeed, previous reports have identified TCTP as an antioxidant enzyme in filarial parasites [15]. TCTP was shown to exhibit an extracellular function as a histamine release factor and to hold anti-apoptotic activity [6]. In addition, the expression of TCTP was upregulated under stress conditions, such as oxidative stress, heat shock, and the presence of metals.

In the present study, a recombinant protein derived from C. glacialis TCTP was expressed in E. coli. The complete nucleotide sequence of the Cg-TCTP was 522 bp in length, and its predicted encoded protein showed high similarity to the T. japonicus (71%). TCTP is highly conserved among eukaryotic organisms. Interestingly, Cg-TCTP was found to comprise two signature regions, named TCTP 1 and TCTP 2, which are structurally similar to the Mss4/Dss4 family [30]. Moreover, it also had basic amino acid-rich regions at 45-56 and 129-152 bp, which were very similar to the MTB and CaB domains, respectively. In accordance with this finding, TCTP was previously described as a calcium-binding protein that protects cells from calcium stress-induced apoptosis [15].

Gnanasekar and Ramaswamy (2007) confirmed that presence of three cysteines located in the central portion of the protein in filarial TCTPs and suggested that these cysteine residues in recombinant TCTP from Brugia malayi were critical for its antioxidant function. However, only two cysteines were identified at 149 and 175 position of the Cg-TCTP sequence [14]. Despite of this difference, the findings herein described clearly suggest that Cg-TCTP may hold antioxidant activity. Notably, Cg-rTCTP-transformed E. coli cells survived under oxidative stress conditions. In the broth culture, Cg-rTCTP expression enabled E. coli cells to survive in the presence of 5 mM H₂O₂ for 24 hr (Fig. 3). However, cell growth on a plate containing 5 mM H₂O₂ was completely inhibited for 12 hr. When the H₂O₂ level was increased to 10 and 20 mM, the growth of transformed and control cells was strongly inhibited (data not shown). It has been reported that recombinant TCTP homologs survive at a maximum concentration of 1.2 mM H₂O₂ [14]. However, in this study, it was confirmed that Cg-rTCTP-producing cells were capable of sustaining growth at high concentrations (3 mM) of H₂O₂. Control cells were incubated with purified TCTP at various concentrations (0, 0.007, 0.07, and 0.7 mg), which revealed that high concentration of TCTP (0.7 mg) enhanced bacterial growth, whereas in the absence of TCTP it was inhibited (data not shown). As shown for the control condition in Fig. 5, as soon as the induced cells were exposed to H₂O₂, growth entered a stationary-like phase. In contrast, the growth of Cg-rTCTP-transformed cells was maintained regardless of H₂O₂ presence, which was similar to the growth profile of control cells not exposed to H₂O₂. Altogether, these results suggest that the TCTP of C. glacialis may have a protective function against H₂O₂-induced damage. Nevertheless, additional studies are still necessary to explore the antioxidative protective mechanisms of C. glacialis TCTP.

Over the past few years, several studies have explored the biologically relevant functions of TCTP. For example, TCTP is a known target for artemisinin and has protective functions against heat stress [3,25]. Artemisinin is a highly valuable drug used to treat malaria [11,31] and is also known to exhibit anticancer and anti-inflammatory activities[9, 10, 32, 33]. Additionally, Eichhorn et al. (2013) suggested that the antimalarial activity of artemisinin may be related to molecular interaction with TCTP [12]. Furthermore, some researchers have suggested that TCTP mRNA is downregulated in yeast cells exposed to heat shock [5], and that TCTP expression is modulated by stresses such as starvation and heat stress [6]. Contrasting to these findings, evaluation of the impact of artemisinin treatment and exposure to heat shock on the growth of Cg-rTCTP-transformed cells failed to show any significant effects (data not shown).

To confirm the antioxidant effect of Cg-TCTP, Cg-rTCTPtransformed E. coli cells were exposed to oxidative conditions using H₂O₂. Overall, the transformed cells showed increased tolerance against oxidative stress, indicating that overexpression of Cg-rTCTPs protect bacterial cells from oxidative damage caused by H₂O₂ exposure. Altogether, this study suggests that Cg-TCTP may have an important function as an antioxidant protein, and its antioxidant effect can be related to improved oxidative stress tolerance of C. glacialis in the harsh environment of the Arctic Ocean. Additional studies are still warranted to provide more information on function of TCTP in C. glacialis in the Antarctic and Arctic Oceans.