Journal of Microbiology and Biotechnology

The Korean Society for Microbiology and Biotechnology (한국미생물·생명공학회)
권호 표지
DOI QR코드

DOI QR Code

Expression of a Tandemly Arrayed Plectasin Gene from Pseudoplectania nigrella in Pichia pastoris and its Antimicrobial Activity

  • Wan, Jin (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Li, Yan (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Chen, Daiwen (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Yu, Bing (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Zheng, Ping (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Mao, Xiangbing (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • Yu, Jie (Institute of Animal Nutrition, Sichuan Agricultural University) ;
  • He, Jun (Institute of Animal Nutrition, Sichuan Agricultural University)
  • Received : 2015.08.31
  • Accepted : 2015.12.03
  • Published : 2016.03.28
Download PDF
⟨ Previous Next ⟩

Abstract

In recent years, various naturally occurring defence peptides such as plectasin have attracted considerable research interest because they could serve as alternatives to antibiotics. However, the production of plectasin from natural microorganisms is still not commercially feasible because of its low expression levels and weak stability. A tandemly arrayed plectasin gene (1,002 bp) from Pseudoplectania nigrella was generated using the isoschizomer construction method, and was inserted into the pPICZαA vector and expressed in Pichia pastoris. The selected P. pastoris strain yielded 143 μg/ml recombinant plectasin (Ple) under the control of the methanol-inducible alcohol oxidase 1 (AOX1) promoter. Ple was estimated by SDS-PAGE to be 41 kDa. In vitro studies have shown that Ple efficiently inhibited the growth of several gram-positive bacteria such as Streptococcus suis and Staphylococcus aureus. S. suis is the most sensitive bacterial species to Ple, with a minimum inhibitory concentration (MIC) of 4 μg/ml. Importantly, Ple exhibited resistance to pepsin but it was quite sensitive to trypsin and maintained antimicrobial activity over a wide pH range (pH 2.0 to 10.0). P. pastoris offers an attractive system for the cost-effective production of Ple. The antimicrobial activity of Ple suggested that it could be a potential alternative to antibiotics against S. suis and S. aureus infections.

Keywords

Introduction

Recently, antibiotics have been widely used in the livestock industry as growth promoters and therapeutic medicines to decrease the susceptibility to diverse infectious diseases [2]. However, their continuous use not only leads to drug resistance [22] but also increases the risk of residues in livestock products [28,30]. Therefore, the development of novel alternatives for antibiotics has attracted considerable research interest [29,35]. Antimicrobial peptides, also called “host defence peptides,” are probably one of the most preferred alternatives because they have been demonstrated to kill bacteria, enveloped viruses and fungi and even transform cancerous cells [19,34]. Compared with conventional antibiotics, antimicrobial peptides have a broader spectrum, a more rapid killing action, and highly selective toxicity [7,37].

Plectasin, the first fungus-derived defensin with therapeutic potential, is primarily isolated from Pseudoplectania nigrella [24]. It is composed of 40 amino acids that fold into an α-β-β structure stabilized by three disulphide bonds (Cys 4 and Cys 30, Cys 15 and Cys 37, and Cys 19 and Cys 39). A previous study has indicated that plectasin is potently active against gram-positive bacteria such as streptococci [26]. Importantly, it does not show any cytotoxicity to mammalian cells such as murine L929 fibroblasts, human erythrocytes, and THP-1 monocytes [3,9]. Thus, plectasin is a potential alternative for conventional antibiotics. However, the production of plectasin by natural microorganisms is still not commercially feasible because of its high cost. Moreover, naturally isolated plectasin is usually contaminated by other substances, complicating the purification process.

The yeast Pichia pastoris can neither utilize nor degrade plectasin, but it possesses many attributes that render it an attractive host for the expression and production of plectasin. As a eukaryote, P. pastoris has many advantages of higher eukaryotic expression systems such as protein processing, protein folding, and posttranslational modification, while being as easy to manipulate as Escherichia coli or Saccharomyces cerevisiae. Moreover, it is easier, faster and less expensive to use than baculovirus or mammalian cell expression systems [1], and generally produces higher expression levels [10]. As a yeast, it shares the advantages of molecular and genetic manipulations with Saccharomyces cerevisiae and has the added advantage of 10- to 100-fold higher heterologous protein expression levels [4,25]. Therefore, P. pastoris offers an ideal expression system for the cost-effective production of plectasin.

In the present study, we describe the cloning and expression of a tandemly arrayed plectasin gene in P. pastoris. The tandem duplication fragment was used because it has been shown to increase the expression level and improve its stability [14,33]. In addition, the antimicrobial activity of Ple was fully characterized. To the best of our knowledge, this is the first report on the heterologous expression of a multimeric plectasin gene in P. pastoris.

 

Materials and Methods

Strains, Media, and Vectors

The P. pastoris X-33 strain was cultivated in Yeast Peptone Dextrose (YPD) medium (1% yeast extract, 2% peptone, and 2% glucose) at 30℃ on a rotary shaker at 150 rpm. The plasmids pMD19-T and pPICZαA were purchased from TaKaRa (Catalog No. 6013, China) and Invitrogen (Catalog No. K1740-01, USA), respectively. Recombinant plasmids were constructed and amplified in E. coli DH5α cultivated at 37℃ in Luria-Bertani (LB) liquid medium or LB agar. Ampicillin for selecting and propagating resistant bacteria was added to a final concentration of 100 μg/ml.

RNA Isolation and Plectasin Gene Cloning

One litre of P. nigrella culture was prepared according to Mygind et al. [24]. The fungal mycelia were harvested by centrifugation and frozen under liquid nitrogen. The frozen mycelia were ground into a fine powder and suspended in a mixture of Trizol reagent (TaKaRa D312, China), and the total cellular RNA fraction was isolated as described by the manual.

The cDNA containing plectasin (without the signal peptide) was amplified by RT-PCR using the following specific primers: up-stream primer F1 (AGAATTCATGATTGAAGGCCGCCTCGAGGGCTTTGGCTGCAAT) and down-stream primer R1 (AGCGGCCGCAAGCTTTTAGTCGACATAGCATTTGCACACA) supplemented with EcoRI/XhoI and SalI/NotI restriction sites, respectively. The PCR was performed in 25 μl reaction mixtures (0.15 μM of each primer, 1 μl of template DNA (approximately 10 ng of first-strand cDNA), and 12.5 μl of PCR premix (Boracker KT201-02)). Denaturation, annealing, and polymerization were carried out for 1 min at 94℃, 1 min at 58℃, and 1 min at 72℃, respectively, for 35 cycles. The amplified PCR products were analysed by agarose gel electrophoresis and directly cloned into the pMD19-T Simple Vector and sequenced by Invitrogen Co., Ltd (China).

Generation of the Tandemly Arrayed Gene

The tandem fragment (with eight copies) was generated using the isoschizomer construction method. The construction strategy is shown in Fig. 1B. Briefly, the plectasin gene was first amplified by PCR using two specific primers (F1 and R1) supplemented with the XhoI (C^TCGAG) and SalI (G^TCGAC) restriction sites, respectively. The amplified plectasin was inserted into a pMD19-T vector and transformed into E. coli DH5α. An identical cohesive end was generated after double-digestion of pMD19T-Ple with XhoI/NotI and SalI/NotI. The new ligation would not be recognized by either of the two enzymes and forms a fragment containing two copies of the plectasin gene. The double-digestion and ligation were aborted until eight copies of the plectasin gene were generated (Ple-8). The plasmid pMD19T-Ple-8 was transformed into E. coli DH5α. To confirm whether the selected clones contained the target fragment, the recombinant plasmid (pMD19T-Ple-8) was extracted and double-digested by EcoRI and NotI.

Fig. 1.Nucleotide sequence of the plectasin gene (A) and construction strategy for the tandemly arrayed gene (B).

Construction of the Expression Vector and Production of Ple

A highly effective vector, pPICZαA, was used to express a tandemly arrayed plectasin gene in P. pastoris. The plasmid pMD19T-Ple-8 was double-digested with EcoRI and NotI, and the isolated DNA fragments were recovered and inserted into the pPICZαA vector. The recombinant plasmid, pPICZαA-Ple-8, was transformed into E. coli DH5α in low-salt LB agar plates containing 25 μg/ml zeocin. The positive clones were identified by colony PCR and sequencing.

Approximately 10-15 μl of pure vector pPICZαA containing Ple-8 was linearized using SacI before transformation into P. pastoris by electroporation (1,800 kV, 50 μF, 186 Ω; Bio-Rad, USA). The positive clones were chosen from the YPD-zeocin agar (100 μg/ml zeocin) at 30℃ and identified by colony PCR and sequencing.

Freshly transformed P. pastoris harbouring the appropriate recombinant plasmid pPICZαA-Ple-8 was incubated on the YPD-zeocin agar (100 μg/ml zeocin) at 30℃ for 48 h. A single positive colony was cultivated in 25 ml of BMGY medium (1% glycerol, 2% peptone, 1% yeast extract, 4 × 10-5% biotin, 1.34% YNB at pH 6.0, and 100 mM potassium phosphate) at 30℃ under constant agitation at 260-280 rpm until the OD600 reached 4 (approx. 16-18 h). Next, cells were collected in sterilized centrifuge tubes and then were centrifuged at 4,000 rpm for 10 min at room temperature. The supernatants were removed and the cell pellets were resuspended in 25 ml of BMMY medium (1.5% methanol, 2% peptone, 1% yeast extract, 4 × 10-5% biotin, 1.34% YNB at pH 6.0, and 100 mM potassium phosphate). Every 24 h, methanol (100%) was added to a final concentration of 0.5% (v/v). The culture supernatant was collected every day by centrifugation. The supernatant was stored at −70℃ before SDS-PAGE and analysis of its antimicrobial activity.

Protein Extraction and Affinity Purification

Protein extraction and purification were performed on ice or at 4℃. The expression culture supernatant was clarified by centrifugation and concentrated approximately 5-fold via an ultrafiltration tube (MW cut-off, 10 kDa; Millipore, Germany). The supernatant (soluble extract) containing the crude Ple proteins was withdrawn and loaded directly onto a 2-ml Ni2+-chelating chromatography column according to the manufacturer’s instructions (Bio-Rad, USA). The elution buffer (300 mM NaCl, 50 mM sodium phosphate, and 500 mM imidazole, pH 8.0) containing purified Ple was stored at −70℃ before SDS-PAGE and analysis of its antimicrobial activities.

SDS-PAGE

SDS-PAGE in 15% polyacrylamide was performed by the Laemmli method [16]. The crude or purified protein fractions were boiled for 5 min and applied to the gel. Proteins were visualized by Coomassie brilliant blue R 250 staining.

Antimicrobial Activity Assays

The antimicrobial activity was determined using the agar radial diffusion method and three strains of gram-negative bacteria (E. coli DH5α, E. coli BL21 (DE3), and Salmonella typhimurium) and three strains of gram-positive bacteria (S. aureus, S. suis, and Enterococcus faecalis) [32]. Briefly, bacteria were cultivated in LB medium at 37℃, 150 rpm for 12 h. Next, 100 μl of bacterial suspension was inoculated into 50 ml of pre-warmed (42℃) LB agar. After rapidly dispersing the bacteria, the medium was poured into sterile petri-dishes. The melted agar was allowed to solidify for 15 min and then was punctured with a sterile ring. Finally, the purified Ple, penicillin, sterile water, and the culture supernatant of P. pastoris were transferred into each hole on the plate at 37℃ for 12 h, and the growth inhibition zone was observed.

For MIC determination, the microtitre broth dilution method was modified for cationic antimicrobial peptides carried out in sterile 96-well microtiter plates [32]. Briefly, bacteria (S. aureus, S. suis, and E. faecalis) were inoculated into 30 ml of Mueller-Hinton Broth (MHB) and grown overnight at 37℃ with shaking (150 rpm). Bacterial cultures were diluted into MHB to obtain a density of 1 × 105 CFU/ml. Next, 100 μl of each bacterial suspension was dispensed into each well of 96-well plates from columns 1 to 11, and 100 μl of 0.01% acetic acid (positive control) was dispensed into column 12. The activity of Ple was tested over the concentration from column 1 (with a final concentration of 0.125 μg/ml) to column 11 (with a final concentration of 128 μg/ml); all assays were performed in triplicates. The plate was incubated at 37℃ for 18-24 h, and the absorption was recorded at 590 nm. MIC was taken as the lowest concentration of Ple that reduces growth by more than 50% compared with that of the positive control.

Stable Analysis (pH, Digestive Enzymes)

The pH stability of purified Ple was determined after a 10-h incubation at 37℃ in a pH gradient of buffered solutions (100 mM), including glycine-HCl buffer (pH 2.0), sodium phosphate buffer (pH 6.0), and glycine-NaOH buffer (pH 10.0) [11]. The proteinase solutions included 2,500 U/mg of pepsin in glycine-HCl buffer (pH 2.0) and 250 U/mg of trysin in Tris-HCl buffer (pH 8.0) [20]. Untreated Ple served as the independent control. Subsequent to each of these treatments, the antimicrobial activity of Ple against S. aureus ATCC 25923 was tested by the agar radial diffusion assay as described above.

 

Results

Cloning of the Plectasin Gene from P. nigrella and Generation of the Tandem Duplication Fragment

The plectasin gene was amplified from first-strand cDNA prepared from P. nigrella using sequence-specific PCR primers. To generate a tandem fragment, two restriction sites (XhoI and SalI) were introduced using specific primers. The nucleotide sequence of plectasin and its deduced amino acid sequences are presented in Fig. 1A (EMBL Accession No. AJ964941). The calculated molecular mass (approximately 4.4 kDa) is in good agreement with that of native plectasin isolated from P. nigrella [24]. The tandem fragment (with eight copies) was generated using the isoschizomer construction method (Fig. 1B). As expected, a 1,002-bp tandem fragment was successfully generated and inserted into the pMD19T vector. To confirm whether the selected clones contained the target fragment, a recombinant plasmid (pMD19T-Ple-8) was extracted and double-digested by EcoRI and NotI. The results are shown in Fig. 2A. The length of the EcoRI-NotI fragment (approximately 1,002 bp) appears to be equal to the calculated size. The result suggested that the tandem plectasin fragment (Ple-8) was successfully generated.

Fig. 2.Results from agarose gel electrophoresis (EcoRI/NotI digestion map). (A) Digestion of the T-clone vectors. Lane M, DNA Marker; Lane 1, pMD19-T-Ple-8 vector (without digestion); Lane 2, pMD19T-Ple-8 vector. (B) Digestion of the recombinant expression vectors. M, DNA Marker; Lane 1, pPICZαA-Ple-8 expression vector; Lane 2, pPICZαA-Ple-8 vector (without digestion).

Vector Construction

Two specific primers (F1 and R1) were designed to incorporate the restriction enzyme sites EcoRI and NotI, respectively, at their 5’ ends, allowing the directional cloning of the Ple-8 gene from pMD19T-Ple-8 into the pPICZαA expression vector. The recombinant vector pPICZαA-Ple-8 was transformed into E. coli DH5α. Primary selection of positive clones was carried out on Luria-Bertani agar with 25 μg/ml zeocin. To confirm whether these clones contained the target fragment, the plasmids were extracted from positive clones and double-digested by EcoRI and NotI. The results are shown in Fig. 2B. The length of the EcoRI-NotI fragment from the positive clones appears to be equal to the fragment inserted into pMD19T. The result suggested that the Ple-8 gene fragment was successfully inserted into pPICZαA as expected (under control of the AOX1 promoter).

Expression of a Tandem Plectasin Gene in P. pastoris and Purification of Ple

The pPICZαA-Ple-8 vector was linearized by SacI and transformed into the P. pastoris X-33 strain by electroporation. The transformants were selected on YPDS plates containing zeocin and the integration of the Ple-8 gene to the AOX1 location in the genome was further confirmed by PCR. A single colony from a positive transformant was induced in 1 L shake flasks using 0.5% methanol. As expected, the size of Ple determined by SDS-PAGE was 41 kDa, a result that is similar to the calculated size (arrow shown in Fig. 3A). The crude protein in the culture supernatant (after 72 h of induction) was concentrated and purified by Ni2+-NTA affinity chromatography. The results from SDS-PAGE verified the successful purification, because only one clear band with a molecular mass of approximately 41 kDa was found (Fig. 3B). The protein assay demonstrated that Ple was purified 1.4-fold by Ni2+-NTA affinity chromatography with 80% recovery. The total Ple yielded by P. pastoris was 143 μg/ml after 72 h of induction. The purified Ple was collected and used to determine its antimicrobial activity.

Fig. 3.SDS–PAGE analysis of Ple produced by P. pastoris. (A) Culture supernatant from recombinant P. pastoris induced by methanol. M, protein markers; Lanes 1-4, culture supernatant from P. pastoris induced by 0.5% methanol at 72, 60, 48, and 24 h, respectively. (B) Purification of Ple. M, protein markers; Lanes 1-2, Ple purified by Ni2+-NTA affinity chromatography.

In Vitro Antimicrobial Activity of Ple

The antimicrobial activity of purified Ple was detected by the agar radial diffusion assay. As shown in Fig. 4A, both Ple (spot 1) and penicillin (spot 2) exhibited strong bactericidal activity against S. aureus and S. suis. However, no inhibition zone was observed around the spots of sterile water (spot 3) and culture supernatant of P. pastoris (spot 4). In addition, the antimicrobial activity of Ple against gram-negative bacteria was detected using E. coli DH5α, E. coli BL21 (DE3), and S. typhimurium. The results showed that only the penicillin (spot 2) displayed clear antimicrobial activity against these bacteria. No inhibition zone was observed around the spot of Ple (spot 1). These results demonstrated that the gram-negative bacteria are less sensitive than gram-positive bacteria to Ple. We also investigated the minimal inhibitory concentration of Ple using various microorganisms (Table 1). Our results clearly indicated that S. suis was the most sensitive bacterium to Ple, with a MIC of 4 μg/ml.

Fig. 4.Assay of the in vitro antimicrobial activity of Ple against gram-positive (A) and gram-negative bacteria (B). Spot 1, 30 μg of purified Ple; Spot 2, 3 μg of penicillin; Spot 3, 30 μl of sterile water; Spot 4, 30 μl of culture supernatant of P. pastoris.

Table 1.“-” without test.

Effects of pH and Proteases on the Antimicrobial Activity of Ple

To determine the effect of pH on the antimicrobial activity of Ple, purified Ple was incubated with different buffers at 37℃ for 10 h. From the agar radial diffusion assay, the purified Ple showed a much lower antimicrobial activity (against S. aureus) at pH 2.0 and 10.0 than at pH 6.0 (Fig. 5). To determine the effect of proteases on its antimicrobial activity, the purified Ple was pre-incubated with a buffered solution containing 2,500 U pepsin or 250 U trypsin. Protease stability analysis showed that Ple could withstand degradation by pepsin. However, it was unstable after trypsin treatment (Fig. 5).

Fig. 5.Proteolysis resistance and pH stability of Ple. S. aureus ATCC 25923 were used for the antimicrobial activity. Spot 1, Ple diluted in buffers containing pepsin (pH 2.0) and incubated at 37℃ for 4 h; Spot 2, Ple diluted in buffers containing trypsin (pH 8.0) and incubated at 37℃ for 4 h; Spots 3-5, Ple was diluted in buffers with different pH values (pH 2.0, pH 6.0, and pH 10.0) and incubated at 30℃ for 10 h, respectively; Spot 6, Untreated Ple.

 

Discussion

Antimicrobial peptides, including various naturally occurring defensins, have attracted considerable research interest owing to their actions on multiple pathogens and the increasing resistance of microorganisms to conventional antibiotics [8]. Plectasin is the first fungus-derived defensin isolated from P. nigrella [24]. However, the production of plectasin by natural microorganisms such as P. nigrella is still not commercially feasible because of its high cost. Currently, heterologous expression has become one of the main tools for the production of recombinant proteins, including antimicrobial peptides [7]. Although P. pastoris was considered to be a favourite expression host because of many advantages as described previously [1,10], the expression of antimicrobial peptides in P. pastoris has to confront two problems; namely, the low expression level of the small antimicrobial peptides and susceptibility to proteolytic degradation [15,17]. In the present study, a tandemly arrayed plectasin gene (Ple-8) was generated and expressed in P. pastoris. Tandemly arrayed genes are a gene cluster created by tandem duplications in which duplicated genes are adjacent to the original. They serve to encode large numbers of genes at a time, enhancing the expression level and possibly increasing its resistance against various proteolytic activities [13,18].

The Ple-8 gene was inserted between a yeast promoter and transcription terminator on multicopy episomal plasmids to achieve high levels of gene expression [25]. For this purpose, we used the strong P. pastoris AOX1 promoter-terminator cassettes. Recombinant proteins can be effectively expressed in P. pastoris and secreted into the medium under the direction of a signal peptide that is fused to the exogenous protein at the N-terminus [5]. As a result, Ple was successfully secreted into the medium with an apparent molecular mass of 41 kDa. The selected P. pastoris strain yielded 143 μg/ml Ple, which is higher than monomeric plectasin from Aspergillus oryzae (50 μg/ml) [27] and E. coli (92 μg/ml) [12], suggesting that the tandem duplication fragment could increase the expression level.

Unlike many defensins with broad-spectrum antimicrobial activity, plectasin only exhibits antimicrobial activity against gram-positive bacteria, including S. aureus, S. suis, and S. pneumoniae [9,24,38]. This f inding suggested that plectasin may have a specific antimicrobial mechanism. Previous studies have shown that plectasin bound to Lipid II [26], thus inhibiting its incorporation into the peptidoglycan, which is the major component of the cell wall of gram-positive bacteria [23]. Ple’s antimicrobial activity against S. suis and S. aureus observed in the present study is compatible with this hypothesis. As shown in Table 1, Ple demonstrated approximately equal activity against S. suis [38] and S. aureus [9] compared with monomeric plectasin. These results suggested that Ple obtained in this study could be a potential alternative to antibiotics against S. suis and S. aureus infections.

The stability of Ple was of great importance because it may be used under different conditions. For animal nutrition and the feed industry, many enzymatic procedures require protein exhibiting activity in a broad pH range and resistance to digestive enzymes. In this study, Ple exhibited resistance to pepsin and maintained its antimicrobial activity (against S. aureus) over a wide pH range from 2.0 to 10.0. The pH resistance was probably due to the higher cysteine content in Ple [36]. Similar stabilities of monomeric plectasin have been reported previously by Zhang et al. [38]. Previous studies have indicated that defensins are rich in basic amino acids and that they are easily digested in vitro by serine-threonine proteases such as trypsin [6,31]. In this study, treatment of Ple with trypsin eliminated its antimicrobial activity. It has been reported that the oxidized form of HβD-3 is highly protected from degradation by trypsin compared with its reduced form [6]. Similarly, the oxidized form of HD-5 peptide exhibited some level of stability against trypsin digestion, but its reduced form was sensitive to trypsin [31]. Furthermore, the eliminated antimicrobial activity after trypsin treatment can be attributed to the reduced disulphides in purified Ple [21].

Our results showed that the stability of Ple (multimeric plectasin) was no less than that of monomeric plectasin and that the expression level was increased in Ple. Future research in our laboratory will be focused on the development of a suitable fermentation strategy to improve Ple production. A tandemly arrayed gene designed for the cost-effective production of Ple in P. pastoris producing large quantities of Ple would be very interesting and attractive.

References

  1. Athmaram TN, Saraswat S, Singh AK, Rao MK, Gopalan N, Suryanarayana VVS, Rao PVL. 2012. Influence of copy number on the expression levels of pandemic influenza hemagglutinin recombinant protein in methylotrophic yeast Pichia pastoris. Virus Genes 45: 440-451. https://doi.org/10.1007/s11262-012-0809-7
  2. Barton MD. 2000. Antibiotic use in animal feed and its impact on human health. Nutr. Res. Rev. 13: 279-299. https://doi.org/10.1079/095442200108729106
  3. Brinch KS, Sandberg A, Baudoux P, Van Bambeke F, Tulkens PM, Frimodt-Møller N, et al. 2009. Plectasin shows intracellular activity against Staphylococcus aureus in human THP-1 monocytes and in a mouse peritonitis model. Antimicrob. Agents Chemother. 53: 4801-4808. https://doi.org/10.1128/AAC.00685-09
  4. Buckholz RG, Gleeson MA. 1991. Yeast systems for the commercial production of heterologous proteins. Nat. Biotechnol. 9: 1067-1072. https://doi.org/10.1038/nbt1191-1067
  5. Cereghino JL, Cregg JM. 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24: 45-66. https://doi.org/10.1111/j.1574-6976.2000.tb00532.x
  6. Dhople V, Krukemeyer A, Ramamoorthy A. 2006. The human beta-defensin-3, an antibacterial peptide with multiple biological functions. BBA Biomembr. 1758: 1499-1512. https://doi.org/10.1016/j.bbamem.2006.07.007
  7. Hancock REW, Patrzykat A. 2002. Clinical development of cationic antimicrobial peptides: from natural to novel antibiotics. Curr. Drug Targets 2: 79-83. https://doi.org/10.2174/1568005024605855
  8. Hancock REW, Sahl HG. 2006. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 24: 1551-1557. https://doi.org/10.1038/nbt1267
  9. Hara S, Mukae H, Sakamoto N, Ishimoto H, Amenomori M, Fujita H, et al. 2008. Plectasin has antibacterial activity and no affect on cell viability or IL-8 production. Biochem. Biophys. Res. Commun. 374: 709-713. https://doi.org/10.1016/j.bbrc.2008.07.093
  10. Hunt I. 2005. From gene to protein: a review of new and enabling technologies for multi-parallel protein expression. Protein Expr. Purif. 40: 1-22. https://doi.org/10.1016/j.pep.2004.10.018
  11. Iwatani S, Zendo T, Yoneyama F, Nakayama J, Sonomoto K. 2007. Characterization and structure analysis of a novel bacteriocin, lacticin Z, produced by Lactococcus lactis QU 14. Biosci. Biotechnol. Biochem. 71: 1984-1992. https://doi.org/10.1271/bbb.70169
  12. Jing XL, Luo XG, Tian WJ, Lv LH, Jiang Y, Wang N, Zhang TC. 2010. High-level expression of the antimicrobial peptide plectasin in Escherichia coli. Curr. Microbiol. 61: 197-202. https://doi.org/10.1007/s00284-010-9596-3
  13. Jonasson P, Nygren PÅ, Jörnvall H, Johansson BL, Wahren J, Uhlén M, Ståhl S. 2000. Integrated bioprocess for production of human proinsulin C-peptide via heat release of an intracellular heptameric fusion protein. J. Biotechnol. 76: 215-226. https://doi.org/10.1016/S0168-1656(99)00195-9
  14. Kim H K, Chun DS, Kim J S, Yun CH, Lee JH, Hong SK, Kang DK. 2006. Expression of the cationic antimicrobial peptide lactoferricin fused with the anionic peptide in Escherichia coli. Appl. Microbiol. Biotechnol. 72: 330-338. https://doi.org/10.1007/s00253-005-0266-5
  15. Kim JM, Jang SA, Yu BJ, Sung BH, Cho JH, Kim SC. 2008. High-level expression of an antimicrobial peptide histonin as a natural form by multimerization and furin-mediated cleavage. Appl. Microbiol. Biotechnol. 78: 123-130. https://doi.org/10.1007/s00253-007-1273-5
  16. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685. https://doi.org/10.1038/227680a0
  17. Lee SJ, Lee JH, Jin HJ, Lee JH, Ryu HY, Kim Y, et al. 2000. A novel technique for the effective production of short peptide analogs from concatameric short peptide multimers. Mol. Cells 10: 236-240. https://doi.org/10.1007/s10059-000-0236-9
  18. Lewis RV, Hinman M, Kothakota S, Fournier MJ. 1996. Expression and purification of a spider silk protein: a new strategy for producing repetitive proteins. Protein Expr. Purif. 7: 400-406. https://doi.org/10.1006/prep.1996.0060
  19. Liu YF, Luo JC, Xu CY, Ren FC, Peng C, Wu GY, Zhao JD. 2000. Purification, characterization, and molecular cloning of the gene of a seed-specific antimicrobial protein from pokeweed. Plant Physiol. 122: 1015-1024. https://doi.org/10.1104/pp.122.4.1015
  20. Luo HY, Huang HQ, Yang PL, Wang YR, Yuan TZ, Wu NF, et al. 2007. A novel phytase appA from Citrobacter amalonaticus CGMCC 1696: gene cloning and overexpression in Pichia pastoris. Curr. Microbiol. 55: 185-192. https://doi.org/10.1007/s00284-006-0586-4
  21. Maemoto A, Qu X, Rosengren KJ, Tanabe H, Henschen-Edman A, Craik DJ, Ouellette AJ. 2004. Functional analysis of the α-defensin disulfide array in mouse cryptdin-4. J. Biol. Chem. 279: 44188-44196. https://doi.org/10.1074/jbc.M406154200
  22. Monroe S, Polk R. 2000. Antimicrobial use and bacterial resistance. Curr. Opin. Microbiol. 3: 496-501. https://doi.org/10.1016/S1369-5274(00)00129-6
  23. Murphey ED, Sherwood ER. 2008. Pretreatment with the gram-positive bacterial cell wall molecule peptidoglycan improves bacterial clearance and decreases inflammation and mortality in mice challenged with Pseudomonas aeruginosa. Microbes Infect. 10: 1244-1250. https://doi.org/10.1016/j.micinf.2008.07.021
  24. Mygind PH, Fischer RL, Schnorr KM, Hansen MT, Sönksen CP, Ludvigsen S, et al. 2005. Plectasin is a peptide antibiotic with therapeutic potential from a saprophytic fungus. Nature 437: 975-980. https://doi.org/10.1038/nature04051
  25. Romanos MA, Scorer CA, Clare JJ. 1992. Foreign gene expression in yeast: a review. Yeast 8: 423-488. https://doi.org/10.1002/yea.320080602
  26. Schneider T, Kruse T, Wimmer R, Wiedemann I, Sass V, Pag U, et al. 2010. Plectasin, a fungal defensin, targets the bacterial cell wall precursor Lipid II. Science 328: 1168-1172. https://doi.org/10.1126/science.1185723
  27. Schnorr KM, Hansen MT, Mygind PH, Segura DR, Hoegenh Kristensen HH, et al. 2011. Antimicrobial polypeptides from Pseudoplectania nigrella. US Patent 7,972,814.
  28. Schwarz S, Kehrenberg C, Walsh TR. 2001. Use of antimicrobial agents in veterinary medicine and food animal production. Int. J. Antimicrob. Agents 17: 431-437. https://doi.org/10.1016/S0924-8579(01)00297-7
  29. Singh MP, Greenstein M. 2000. A ntibacterial l eads from microbial natural products discovery. Curr. Opin. Drug Discov. Devel. 3: 167-176.
  30. Smith DL, Harris AD, Johnson JA, Silbergeld EK, Morris JG. 2002. Animal antibiotic use has an early but important impact on the emergence of antibiotic resistance in human commensal bacteria. Proc. Natl. Acad. Sci. USA 99: 6434-6439. https://doi.org/10.1073/pnas.082188899
  31. Tanabe H, Ayabe T, Maemoto A, Ishikawa C, Inaba Y, Sato R, et al. 2007. Denatured human α-defensin attenuates the bactericidal activity and the stability against enzymatic digestion. Biochem. Biophys. Res. Commun. 358: 349-355. https://doi.org/10.1016/j.bbrc.2007.04.132
  32. Tian ZG, Dong TT, Yang YL, Teng D, Wang JH. 2009. Expression of antimicrobial peptide LH multimers in Escherichia coli C43 (DE3). Appl. Microbiol. Biotechnol. 83: 143-149. https://doi.org/10.1007/s00253-009-1893-z
  33. Tian ZG, Teng D, Yang YL, Luo J, Feng XJ, Fan Y, et al. 2007. Multimerization and fusion expression of bovine lactoferricin derivative LfcinB15-W4,10 in Escherichia coli. Appl. Microbiol. Biotechnol. 75: 117-124. https://doi.org/10.1007/s00253-006-0806-7
  34. Vizioli J, Salzet M. 2002. Antimicrobial peptides versus parasitic infections? Trends Parasitol. 18: 475-476. https://doi.org/10.1016/S1471-4922(02)02428-5
  35. Wang XQ, Yang F, Liu C, Zhou HJ, Wu GY, Qiao SY, et al. 2012. Dietary supplementation with the probiotic Lactobacillus fermentum I5007 and the antibiotic aureomycin differentially affects the small intestinal proteomes of weanling piglets. J. Nutr. 142: 7-13. https://doi.org/10.3945/jn.111.147074
  36. Yamada O, Sakamoto K, Tominaga M, Nakayama T, Koseki T, Fujita A, Akita O. 2005. Cloning and heterologous expression of the antibiotic peptide (ABP) genes from Rhizopus oligosporus NBRC 8631. Biosci. Biotechnol. Biochem. 69: 477-482. https://doi.org/10.1271/bbb.69.477
  37. Zasloff M. 2002. Antimicrobial peptides of multicellular organisms. Nature 415: 389-395. https://doi.org/10.1038/415389a
  38. Zhang J, Yang YL, Teng D, Tian ZG, Wang SR, Wang JH. 2011. Expression of plectasin in Pichia pastoris and its characterization as a new antimicrobial peptide against Staphyloccocus and Streptococcus. Protein Expr. Purif. 78: 189-196. https://doi.org/10.1016/j.pep.2011.04.014

Cited by

  1. Fungal proteinaceous compounds with multiple biological activities vol.100, pp.15, 2016, https://doi.org/10.1007/s00253-016-7671-9
  2. Dietary chitosan oligosaccharide supplementation improves foetal survival and reproductive performance in multiparous sows vol.6, pp.74, 2016, https://doi.org/10.1039/c6ra13294d
  3. New insights into the role of chitosan oligosaccharide in enhancing growth performance, antioxidant capacity, immunity and intestinal development of weaned pigs vol.7, pp.16, 2016, https://doi.org/10.1039/c7ra00142h
  4. Maternal chitosan oligosaccharide supplementation during late gestation and lactation affects offspring growth vol.17, pp.4, 2016, https://doi.org/10.1080/1828051x.2018.1435313
  5. Alginate oligosaccharide-induced intestinal morphology, barrier function and epithelium apoptosis modifications have beneficial effects on the growth performance of weaned pigs vol.9, pp.1, 2016, https://doi.org/10.1186/s40104-018-0273-x
  6. Expression, Purification and Characterization of a Novel Antimicrobial Peptide: Gloverin A2 from Bombyx mori vol.25, pp.3, 2016, https://doi.org/10.1007/s10989-018-9732-7
  7. The Use of Chitosan, Alginate, and Pectin in the Biomedical and Food Sector-Biocompatibility, Bioadhesiveness, and Biodegradability vol.11, pp.11, 2016, https://doi.org/10.3390/polym11111837
  8. Strategies for recombinant production of antimicrobial peptides with pharmacological potential vol.13, pp.4, 2020, https://doi.org/10.1080/17512433.2020.1764347